I’m running out of time for this month’s published-code-critique. Luckily, Nature’s front page had this gem: a paper literally referring back to the days of Mendel1!
This month’s paper: Feng C et al.. Genomic and genetic insights into Mendel’s pea genes. Nature 2025. doi: 10.1038/s41586-025-08891-6
Original code
This paper’s code is on GitHub.
Critique
Standard disclaimer: issues with published code are not necessarily anyone’s fault, and often are due to nothing more nefarious than time constraints.
Be specific about dependencies
Off the main through-line of this post, but I had to mention it. The directory README is decent at describing the steps at a high level. That is part of my system for directory READMEs. However, there’s a major omission: a list of dependencies. Just this line:
Most scripts need to be run in a Linux/Unix environment and depend on common bioinformatics tools.
Except… what exactly are “common bioinformatics tools”? Those differ wildly by sub-field. Even if I knew the tools, which versions numbers were used? Any change to any tool might break the scripts.
I understand it’s annoying, but a key part of making reproducible code is documenting version numbers.
Use line breaks
The README says to run things in order, so I’m going to the first file:
00.SNP_calling_and_QC/00.QC2fastq.sh. One line is over 300 characters:
#!/bin/bash
for sample in $(cat zz_samle.list); do
echo "fastp -i ${sample}_1.fastq.gz -I ${sample}_2.fastq.gz -o ${sample}_1.fastp.fastq.gz -O ${sample}_2.fastp.fastq.gz --adapter_sequence=AGTCGGAGGCCAAGCGGTCTTAGGAAGACAA --adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -w 5 -f 5 -F 5 -l 80 -g -j ${sample}.json -h ${sample}.html" > "${sample}.fastp.sh"
done
You don’t need to limit your files to 79 characters, but there’s a limit. This is well over it. There is no reasonable way to read the whole line at once. Even auto-wrapping has a tendency to mess code up visually. If the statement needs to be that long, please for the love of readability use line breaks. For example:
#!/bin/bash
for sample in $(cat zz_samle.list); do
echo "fastp -i ${sample}_1.fastq.gz -I ${sample}_2.fastq.gz \
-o ${sample}_1.fastp.fastq.gz -O ${sample}_2.fastp.fastq.gz \
--adapter_sequence=AGTCGGAGGCCAAGCGGTCTTAGGAAGACAA \
--adapter_sequence_r2=AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA \
-w 5 -f 5 -F 5 -l 80 -g \
-j ${sample}.json -h ${sample}.html" > "${sample}.fastp.sh"
done
Voila, everything is readable. Lne-breaks also break it up into sub-sections (e.g. input arguments here, output arguments there).
Beyond the line break issue, I’m not sure what this is doing? I can see it’s
sending a fastp command to a file, but why these specific arguments? Another
benefit of breaking up a long line: each part could get an explanatory comment.
Use indentation
On to the next script, 00.SNP_calling_and_QC/01.fastq2gvcf.sh. Line lengths
are shorter (the longest is “only” around 200 characters) but there is a new
readability issue: indentation. Specifically, indentation within blocks:
for library in `grep $sample sample_lib.list | cut -f 2 -d ","`;
do
fq1=$data_path/$sample/${sample}_${library}_1.fastp.fastq.gz
fq2=$data_path/$sample/${sample}_${library}_2.fastp.fastq.gz
group=$library
platform="ILLUMINA"
bam_option="--bam_compression 1"
echo "time ( $sentieon_path/bin/sentieon bwa mem -M -R '@RG\tID:$group\tPL:$platform\tLB:$library\tSM:$sample' -t $nt \
-K 10000000 $ref_genome $fq1 $fq2 || echo -n 'error' ) | $sentieon_path/bin/sentieon util sort $bam_option \
-r $ref_genome -o ${sample}.${library}.sort.bam -t $nt --sam2bam -i -
">>${sample}/${sample}.sentieon.sh
all="$all ${sample}.${library}.sort.bam"
done
multi=2
runs=$(grep $sample sample_lib.list | cut -f 2 -d ","|wc -l)
if [ $runs -ge $multi ];then
echo "samtools merge -@ $nt ${sample}.sorted.bam $all && rm $all ${all}.bai
samtools index -@ $nt ${sample}.sorted.bam
" >>${sample}/${sample}.sentieon.sh
else
echo "mv ${sample}.${library}.sort.bam ${sample}.sorted.bam
rm ${sample}.${library}.sort.bam.bai
samtools index -@ $nt ${sample}.sorted.bam
" >>${sample}/${sample}.sentieon.sh
fi
Where does the for loop start and end? How about the if statement, and its
else block? Are there any blocks nested inside of either of those?
Some code viewers will make this a little easier to scan by e.g. using colors. Even then it’s a difficult. But there’s a simple, better way:
for library in `grep $sample sample_lib.list | cut -f 2 -d ","`;
do
fq1=$data_path/$sample/${sample}_${library}_1.fastp.fastq.gz
fq2=$data_path/$sample/${sample}_${library}_2.fastp.fastq.gz
group=$library
platform="ILLUMINA"
bam_option="--bam_compression 1"
echo "time ( $sentieon_path/bin/sentieon bwa mem -M -R '@RG\tID:$group\tPL:$platform\tLB:$library\tSM:$sample' -t $nt \
-K 10000000 $ref_genome $fq1 $fq2 || echo -n 'error' ) | $sentieon_path/bin/sentieon util sort $bam_option \
-r $ref_genome -o ${sample}.${library}.sort.bam -t $nt --sam2bam -i -
">>${sample}/${sample}.sentieon.sh
all="$all ${sample}.${library}.sort.bam"
done
multi=2
runs=$(grep $sample sample_lib.list | cut -f 2 -d ","|wc -l)
if [ $runs -ge $multi ];then
echo "samtools merge -@ $nt ${sample}.sorted.bam $all && rm $all ${all}.bai
samtools index -@ $nt ${sample}.sorted.bam
" >>${sample}/${sample}.sentieon.sh
else
echo "mv ${sample}.${library}.sort.bam ${sample}.sorted.bam
rm ${sample}.${library}.sort.bam.bai
samtools index -@ $nt ${sample}.sorted.bam
" >>${sample}/${sample}.sentieon.sh
fi
See how much easier this is to scan? Even a cursory glance reveals the basic block structure, and it’s easy to know what is inside of what.
Some programming languages (cough cough Python) enforce indentation. Many don’t. Still, you should always use proper indentation. It has massive readability benefits, especially with more complicated block structures. With a few levels of nesting and few sub-blocks per level, the reader will be lost fast without indentation as an anchor and guide for the eye2.
Those two latter sections are the big things. Glancing through some of the other scripts, I have quibbles (e.g. the Python ones lack spaces after the commas in function calls, and have generally inconsistent whitespace). However, those pale in comparison to the massive readability issues caused by failing to indent and failing to use line breaks. Please format your code, y’all. You have to read it too.
If there’s a recent paper you’d like me to look through, shoot me an email. Address in my CV.
- The Mendelian genetics from 9th grade bio is why I fell in love with biology.
- I have no idea how this works for screen readers.